Review



mutant allele plant codon optimized cas9 potato intron  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Addgene inc mutant allele plant codon optimized cas9 potato intron
    Mutant Allele Plant Codon Optimized Cas9 Potato Intron, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plant+codon+optimized+cas9/px330+u6+chimeric+bb+cbh+hspcas9/pm34181787-237-3-15
    Average 90 stars, based on 1 article reviews
    mutant allele plant codon optimized cas9 potato intron - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Two MYB proteins in a self-organizing activator-inhibitor system produce spotted pigmentation patterns
    Article Snippet: The guides were pre-tested for their cleavage efficiency with an in vitro assay system using S. pyogenes Cas9 nuclease (New England Biolabs) to edit a PCR-amplified double-stranded DNA fragment of RTO . .. A binary plasmid construct expressing plant-codon-optimized Cas9 (pFGC-pcoCas9; Addgene#52256) was modified to express a RTO sgRNA (TTTCGAATGCACAAGCTCGT) that was successful in vitro . ..

    Construct:

    Article Title: Two MYB proteins in a self-organizing activator-inhibitor system produce spotted pigmentation patterns
    Article Snippet: The guides were pre-tested for their cleavage efficiency with an in vitro assay system using S. pyogenes Cas9 nuclease (New England Biolabs) to edit a PCR-amplified double-stranded DNA fragment of RTO . .. A binary plasmid construct expressing plant-codon-optimized Cas9 (pFGC-pcoCas9; Addgene#52256) was modified to express a RTO sgRNA (TTTCGAATGCACAAGCTCGT) that was successful in vitro . ..

    Expressing:

    Article Title: Two MYB proteins in a self-organizing activator-inhibitor system produce spotted pigmentation patterns
    Article Snippet: The guides were pre-tested for their cleavage efficiency with an in vitro assay system using S. pyogenes Cas9 nuclease (New England Biolabs) to edit a PCR-amplified double-stranded DNA fragment of RTO . .. A binary plasmid construct expressing plant-codon-optimized Cas9 (pFGC-pcoCas9; Addgene#52256) was modified to express a RTO sgRNA (TTTCGAATGCACAAGCTCGT) that was successful in vitro . ..

    Modification:

    Article Title: Two MYB proteins in a self-organizing activator-inhibitor system produce spotted pigmentation patterns
    Article Snippet: The guides were pre-tested for their cleavage efficiency with an in vitro assay system using S. pyogenes Cas9 nuclease (New England Biolabs) to edit a PCR-amplified double-stranded DNA fragment of RTO . .. A binary plasmid construct expressing plant-codon-optimized Cas9 (pFGC-pcoCas9; Addgene#52256) was modified to express a RTO sgRNA (TTTCGAATGCACAAGCTCGT) that was successful in vitro . ..

    In Vitro:

    Article Title: Two MYB proteins in a self-organizing activator-inhibitor system produce spotted pigmentation patterns
    Article Snippet: The guides were pre-tested for their cleavage efficiency with an in vitro assay system using S. pyogenes Cas9 nuclease (New England Biolabs) to edit a PCR-amplified double-stranded DNA fragment of RTO . .. A binary plasmid construct expressing plant-codon-optimized Cas9 (pFGC-pcoCas9; Addgene#52256) was modified to express a RTO sgRNA (TTTCGAATGCACAAGCTCGT) that was successful in vitro . ..



    Similar Products

    90
    Addgene inc mutant allele plant codon optimized cas9 potato intron
    Mutant Allele Plant Codon Optimized Cas9 Potato Intron, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plant+codon+optimized+cas9/px330+u6+chimeric+bb+cbh+hspcas9/pm34181787-237-3-15
    Average 90 stars, based on 1 article reviews
    mutant allele plant codon optimized cas9 potato intron - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    Addgene inc plant codon optimized cas9
    Plant Codon Optimized Cas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plant+codon+optimized+cas9/pFGC-pcoCas9+(Plasmid+%2352256)/pmc07156294-805-5-8
    Average 94 stars, based on 1 article reviews
    plant codon optimized cas9 - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    GenScript corporation plant-codon-optimized streptococcus pyogenes cas9 and single guide rna (sgrna)
    Plant Codon Optimized Streptococcus Pyogenes Cas9 And Single Guide Rna (Sgrna), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plant+codon+optimized+cas9/cas9+protein/pm31182809-497-5-12
    Average 90 stars, based on 1 article reviews
    plant-codon-optimized streptococcus pyogenes cas9 and single guide rna (sgrna) - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results